Abstract
In the original article, there were two errors. First, an incorrect NCBI accession number was provided. A correction has been made to Methods, Bioinformatic Analyses, Paragraph 4: "All raw sequences are available from NCBI (accession SRP095769). Assemblies and annotation data are available from IMG/M ER (http://img.jgi.doe.gov/mer; Taxon OIDs 3300009572, 3300009536, and 3300010936)." Additionally, in the original article, the two primer sets used for nested nifH PCR were listed in the incorrect order and included an incorrect reference. A correction has been made to Methods, Nucleic Acid Extraction, Amplification, and Sequencing, Paragraph 3: "The nifH gene was amplified using nested degenerate nifH primers (Zehr and McReynolds, 1989; Zani et al., 2000). The first round contained 1X PCR buffer, 0.1U Platinum High Fidelity Taq polymerase (Invitrogen), 200 μmol L-1 dNTPs, 3% BSA, 4 mmol L-1 Mg2+, 1 μL DNA or cDNA, and 1 μmol L-1 nifH3 and nifH4 primers (Zani et al., 2000). Reaction conditions were: 94°C for 7 min, followed by 30 cycles of 94°C for 1 min, 57°C for 1 min, and 72°C for 1 min, and a final 72°C extension for 7 min. The second round of nifH PCR used the same components and thermocycling conditions as the first round, except the DNA extract was replaced with 1 μL of the amplified product generated during the first round PCR reaction, and custom primers were used, consisting of gene-specific sites (nifH1 and nifH2), dual- indexed barcodes, Illumina linkers, and a sequencing primer binding region, similar to those described by Kozich et al. (2013; Table S1). PCR negative controls and filter blank samples were included in PCR reactions." Finally, there was a mistake in the legend for Supplementary Table 1 as published. This table listed the incorrect nifH primer names. The correct legend appears below. Table S1: Dual-index barcoded, forward and reverse nifH primers (5' → 3') used in this study. Sample barcodes are shown in bold. Forward and reverse nifH PCR primers are indicated by nifH1 (TGYGAYCCNAARGCNGA) and nifH2 (ADNGCCATCATYTCNCC; note the misprint of this primer in the original manuscript by Zani et al., 2000). NNNN indicate Illumina linker regions: AATGATACGGCGACCACCGAGATCTACAC (forward) and CAAGCAGAAGACGGCATACGAGAT (reverse). Blue text indicates the binding site for sequencing primers, which were designed to optimize melting temperature during sequencing, as described by Kozich et al. (2013). The authors apologize for these errors and state that they do not change the scientific conclusions of the article in any way.
| Original language | English |
|---|---|
| Article number | 1780 |
| Journal | Frontiers in Microbiology |
| Volume | 8 |
| Issue number | SEP |
| DOIs | |
| State | Published - Sep 19 2017 |
UN SDGs
This output contributes to the following UN Sustainable Development Goals (SDGs)
-
SDG 14 Life Below Water
Keywords
- 16S rRNA
- Heterotrophic marine diazotrophs
- Marine microbiome
- Metagenomics
- Nitrogen fixation
- Trichodesmium
- nifH diversity
Fingerprint
Dive into the research topics of 'Corrigendum: Microbiome of Trichodesmium colonies from the north pacific subtropical gyre[Front. Microbiol, 8,(2007)(1122)]doi: 10.3389/fmicb.2017.01122'. Together they form a unique fingerprint.Research output
- 1 Citations
- 1 Article
-
Microbiome of Trichodesmium colonies from the North Pacific Subtropical Gyre
Gradoville, M. R., Crump, B. C., Letelier, R. M., Church, M. J. & White, A. E., Jul 6 2017, In: Frontiers in Microbiology. 8, JUL, 1122.Research output: Contribution to journal › Article › peer-review
Open Access25 Scopus citations
Cite this
- APA
- Author
- BIBTEX
- Harvard
- Standard
- RIS
- Vancouver